Determination of the mutation
responsible for Familial Nephropathy (FN) in the English Cocker Spaniel
and use of a canine microarray to examine gene expression in FN
Principal
investigator: Keith E. Murphy,
Ph.D.
Associate Professor of Genetics and Veterinary
Pathobiology
Department of Veterinary Pathobiology
College of Veterinary Medicine
Texas A&M University
College Station, TX 77843-4467
979-845-2720
(telephone); 979-845-9231 (facsimile)
kmurphy@cvm.tamu.edu
Amount requested:
$78,000 to be disbursed over one year
_____________________________
____________________________
Principal
Investigator
Administrator of Grants
Table of Contents
Summary
1
Detailed
budget 2
Biographical
sketches 3
Related research
support 5
Facilities
5
Preliminary
studies 6
Research
plan
8
Summary
The
English Cocker Spaniel (ECS) and a kindred of mixed-breed dogs have an
inherited familial nephropathy (FN) clinically and morphologically
similar to human X-linked Alport syndrome (XLAS) and autosomal recessive
Alport Syndrome (ARAS), respectively. XLAS in the mixed breed kindred is
caused by a nonsense mutation in COL4A5, and to date the cause of
ARAS is unknown but the mutation is in either COL4A3 or COL4A4.
Our primary objective is
to identify the causative mutation for FN in the ECS.
Once this is accomplished a genetic test to identify carriers and at
risk dogs will be rapidly developed. Our second objective is to assess
the genetic changes that accompany FN. Transcriptional profiling of
glomeruli from dogs exhibiting advanced renal dysfunction resulting from
XLAS and ARAS and related, normal dogs of similar age will be performed
using a canine oligonucleotide array. The transcriptional profiling data
may show marked differences in gene expression that are correlated with
morphologic changes present in kidneys from XLAS and ARAS-affected dogs.
Quantitative RT-PCR will be used to confirm the microarray expression
profiles of clinically interesting genes. This latter work will shed
light on gene expression not only in FN but also for end stage renal
disease, a common cause of death for the dog. Note:
The terms FN and AS are to be
taken synonymously, are interchangeable and are both used in this
proposal.
Detailed Budget
(August 1, 2004---July 31, 2005)
Salaries/fringe benefits for doctoral
students $58,000
Supplies, gene chips and Taqman assays by Viagen,
Inc.
$20,000
Total cost:
$78,000
|
NAME
Murphy, Keith |
POSITION
TITLE Associate Professor |
|
EDUCATION/TRAINING
|
|
INSTITUTION AND LOCATION |
DEG. |
YEAR
CONF. |
FIELD OF STUDY |
|
Indiana University,
Bloomington, IN |
B.S. |
1982 |
Microbiology |
|
University of Cincinnati
Medical School, Cincinnati, OH |
M.S. |
1986 |
Molecular Genetics &
Microbiology |
|
Louisiana State University,
Baton Rouge, LA |
Ph.D. |
1989 |
Genetics & Microbiology |
Professional Experience
1989-1991
Northwestern University Medical School, Chicago, Illinois,
Postdoctorate in Department of Cell and Molecular Biology
1991-1993
Agricultural Research Service, Arthropod-borne Animal Diseases
Research Laboratory
Laramie, Wyoming, Postdoctoral Research Geneticist
1993-1995 The Citadel, Charleston, South
Carolina, Assistant Professor of Biology
1996-1998
The University of Memphis, Memphis, Tennessee, Assistant
Professor of Molecular
Genetics
1998-1999
The University of Memphis, Memphis, Tennessee, Associate
Professor of Molecular
Genetics
1999- Texas A&M University College of
Veterinary Medicine, College Station, Texas, Associate Professor of
Veterinary Pathobiology, Genetics and Biotechnology
Current Research Support
(extramural only)
Cargill, E.J. and K.E. Murphy
(mentor/sponsor). Genetic analyses of hereditary deafness: a canine
model. Individual National Research Service Award (predoctoral).
NIH-NIDCD. $80,459. 2001-2004.
Murphy,
K.E. (PI). Whole genome screen for analysis of progressive retinal
atrophy in the American Eskimo Dog. North American Eskimo Dog
Association. $69,000. 2003-2004.
Greer, K.A. and K.E. Murphy
(mentor/sponsor). Understanding genetics of aging: Canis
familiaris model. Individual National Research Service Award
(postdoctoral). NIH-NIA. $79,000 ($39,500/year). 2003-2005.
Lees, G.E. (PI), K.E. Murphy
(Co-I) et al. Gene transfer therapy for Alport syndrome.
NIH-NIDDK. 1RO1DK064273. First year funding, $441,576;Total, $2,738,929.
2003-2008.
Murphy,
K.E. Multiplexing of canine minimal screening set 2. Canine Health
Foundation. $54,000. 2004-2005.
Murphy,
K.E. Pilot Study: Genetics of post-squalene cholesterol biosynthesis in
the domestic dog: possible roles in developmental abnormalities. Canine
Health Foundation. $13,600. 2004-2005.
Selected Publications
(since 1999)
Wang, X., A.B. Miller, J.D.
Scott, A.J. Lepine and K.E. Murphy (1999). Analysis of randomly
amplified polymorphic DNA (RAPD) for identifying genetic markers
associated with canine hip dysplasia. Journal of Heredity
90 (1): 99-103.
Miller, A.B., M. Breen and K.E.
Murphy (1999). Chromosomal localization of acidic and basic
keratin gene clusters of Canis lupus familiaris. Mammalian
Genome 10 (4): 371-375.
Credille, K.M., P.J. Venta, M.
Breen, J.K. Lowe, K.E. Murphy, E.A. Ostrander, F. Galibert and
R.W. Dunstan (2001). Characterization and physical mapping of the canine
transglutaminase 1 gene. Cytogenetics and Cell Genetics
93: 73-76.
Miller, A.B., J.K. Lowe, E.A.
Ostrander and K.E. Murphy (2001). Cloning, sequence analysis and
radiation hybrid mapping of a mammalian krt2p gene.
Functional and Integrative Genomics 1: 305-311.
Shin, T., D. Kraemer, J. Pryor,
L. Liu, J. Rugila, L. Howe, S. Buck, K. Murphy, L. Lyons and M.
Westhusin (2002). A cat cloned by nuclear transplantation. Nature
415: 859.
Cargill, E.J., L.A. Clark, J.M.
Steiner and K.E. Murphy (2002). Multiplexing of canine
microsatellite markers for whole genome screens. Genomics
80 (3): 250-253.
Moeller, E.M., J.M. Steiner,
L.A. Clark, K.E. Murphy, T.R. Famula, D.A. Williams, M.E.
Stankovics and A.S. Vose (2002). Inheritance of pancreatic acinar
atrophy in German Shepherd Dogs in the USA. American Journal of
Veterinary Research 63 (10): 1429-1434.
Cox, M.L., P. Quignon, F.
Galibert, G.E. Lees and K.E. Murphy (2003). Sequencing and
radiation hybrid mapping of canine Uromodulin. DNA Sequence
14: 61-69.
Lowe, J.K., R. Guyon, M.L.
Cox, D.C. Mitchell, A.L. Lonkar, F. Lingaas, C. Andre, F. Galibert, E.A.
Ostrander and K.E. Murphy (2003). Radiation hybrid mapping
of the canine type I and type IV collagen gene subfamilies.
Functional and Integrative Genomics 3: 112-116.
Cox, M.L., C.E. Kashtan, G.E.
Lees and K.E. Murphy (2003). Genetic cause of X-linked
Alport syndrome in a family of domestic dogs. Mammalian Genome
14: 396-403.
Greer, K.A., E.J. Cargill, L.A.
Clark, M.L. Cox, K.L. Tsai, R.W. Dunstan, P.J. Venta, K.M. Credille and
K.E. Murphy (2003). Digging up the canine genome---a tale to wag
about. Invited review for Cytogenetic and Genome Research
102: 244-248.
Tsai, K.L., R. Guyon and K.E.
Murphy (2003). Identification of isoforms and radiation hybrid
mapping of canine c-kit. Cytogenetic and Genome Research
102: 261-268.
Cargill, E.J., T.R. Famula, G.M.
Strain and K.E. Murphy (2004). Heritability and segregation
analysis of deafness in US Dalmatians. Genetics 166:
1385-1393.
Cargill, E.J, R.D. Schnabel and
K.E. Murphy (2004). Assignment of canine MSS1 microsatellite
markers to chromosomes by linkage. DNA Sequence 15:
209-213.
Clark, L.A., T.R. Famula and K.E.
Murphy (2004). A rapid, single multiplex microsatellite-based
assay for use in canine forensics. American Journal of Veterinary
Research (in press).
Clark, L.A., Tsai, K.L.,
Steiner, J.M., Williams, D.A., Guerra, T., Ostrander, E.A., Galibert,
F., Murphy, K.E. (2004). Chromosome-specific microsatellite
multiplex sets for linkage studies in the domestic dog. Genomics.
84: 550-554.
Credille, K.M., R. Guyon, C.
André, K.E. Murphy, K. Tucker, K.F. Barnhart and R.W. Dunstan
(2004). Comparative sequence analysis and radiation hybrid mapping of
two epidermal type II keratin genes in the dog: keratin 1 and keratin
2e. Cytogenetic and Genome Research (in press).
Greer, K.A., S.C. Zienko and K.E.
Murphy (2004). Statistical analysis regarding effects of height
and weight on lifespan of the domestic dog. Submitted to
The Veterinary Journal.
Henske, J.A., T.R. Famula and
K.E. Murphy (2004). Identification of microsatellite markers
linked to progressive retinal atrophy in the American Eskimo Dog.
Submitted to Veterinary Ophthalmology.
Clark, L.A., Steiner J.M., Zhou
W., Wan J., Williams D.A., Murphy K.E. (2004). Gene expression
profile of pancreatic acinar atrophy in the German Shepherd Dog.
Submitted to Animal Biotechnology
Gustafson, T.L.,
G. Evanno, E. Cadieu and K.E.
Murphy (2004). Identification and mapping of canine DNA repair
genes. Submitted to DNA Sequence.
Cox, M.L, M.A. Higgins, B. Li,
K.A. Greer, T.P. Ryan, B.R. Berridge, C.E. Kashtan, G.E. Lees
and K.E. Murphy (2004). Gene expression in canine X-linked Alport
syndrome. To be submitted (8/04) to Proceedings of the National
Academy of Sciences.
Related Support
The
PI does not hold any funding related to the proposed project. Other
funding from the CHF to the PI is for projects concerned with (1)
multiplexing and (2) cholesterol metabolism. The total awarded for these
two projects is $67,600. The multiplex project is complete and a
manuscript is in press in Genomics. Finally, the PI is involved
with the Pug Dog encephalitis project for which Dr. Kimberly Greer is
the lead scientist.
Facilities
The
proposed research will be carried out within the Department of
Veterinary Pathobiology at the Texas A&M University College of
Veterinary Medicine. Laboratory and office space allocated to the PI is
approximately 1200 sq. feet. Eight doctoral students and two
postdoctorates are currently working in the laboratory. They are
supported through grants and fellowships from the University and the NIH.
The equipment, supplies and reagents in the laboratory were purchased
using start-up funds and grant funds and include: canine BAC library,
molecular biology reagents and kits, -80oC freezer,
refrigerators, freezers, hybridization oven, eight thermal cyclers,
numerous apparatuses for vertical and horizontal electrophoresis, UV
cross-linker, power supplies, table top high speed centrifuge and
rotors, microcentrifuges, spectrophotometer, top-loading and analytical
balances, vacuum blotter, trans-illuminator and Alpha Imager
photodocumentation system, water baths, Precision 2000 automated
microplate pipetting system, incubator, -20oC freezer,
orbital shaking incubator, rocking platforms, laboratory expendables (e.g.,
gloves, microfuge tubes, 15mL/50ml tubes, pipette tips, petri plates,
glassware), film, nitrocellulose, chemicals, micropipetting devices,
software programs for pedigree and DNA/protein sequence analyses (e.g.,
Progeny, Vector NTI, GeneMapper) and molecular biology technical
reference texts (Current Protocols in Molecular Biology and
Current Protocols in Human Genetics are on CD-ROM). The facilities
and equipment (e.g., cold rooms, media resources, computer
laboratories, speed vac concentrators, ultracentrifuges, pulsed field
gel electrophoresis units, scintillation counters, etc.)
typically found at research-oriented institutions are present in very
close proximity to the laboratory. The Department of Veterinary
Pathobiology also houses the DNA Technologies Core Laboratory. This
service center has multiple DNA sequencers (ABI models).
The laboratory has eleven
personal computers (PC and Macintosh models), Hewlett Packard laser
printers, desk jest printers and Hewlett Packard color scanners. All
computers are wired for connection to the internet through the CVM
system. Computer support services are superior.
Preliminary studies demonstrating expertise of
PI
A colony of mixed breed
Navasota (NAV) dogs suffering from FN was first established at Texas A&M
University in October, 1998, for studies initiated by Dr. George Lees
(Lees et al. 1998) and the status of the dogs was determined by skin
immunohistochemistry. When antibody staining is performed for the
detection of COL4A5 in this colony of dogs, affected dogs are found to
have no COL4A5 protein expression while unaffected dogs showed normal
COL4A5 protein distribution in the glomerular basement membrane (GBM).
COL4A5 staining in carrier females showed a mosaic pattern of
expression. Navasota Dog FN thus exhibits the immunochemical and genetic
features of X-linked Alport syndrome (XLAS).
Sequencing of COL4A5 was
performed and a 10bp deletion in exon 9 was discovered (Cox et al.
2000). This deletion causes a frameshift that leads to a premature stop
codon in exon 10, thus the protein is truncated and nonfunctional. (Fig.
1)
Amino
Acid Sequence (Exons 9 and 10, with frame-shift and premature stop codon)
E P G S I I M S S L P G P K G N P G Y P G
P P
Normal
GAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGGTAATCCAGGATATCCAGGTCCTCCT
Affected
GAACCAGGTAGTATAATTATGTCATCACTGCCAGGACCAAAGGG----------TATCCAGGTCCTCCT
E P G S I I M S S L P G P K G I Q V
L L
G I Q G P A G P T G L P G P I G P P G P P
G L
Normal
GGAATACAAGGCCCAGCTGGTCCCACTGGTTTACCAGGGCCAATTGGTCCCCCAGGACCACCTGGTTTGA
Affected GGAATACAAGGCCCAGCTGGTC
CCACTGGTTTACCAGGGCCAATTGGTCCCCCAGGACCACCTGGTTTGA
E Y K A Q L V P L V Y Q G Q L V P Q D H L
V *
Figure
1. Nucleotide and amino acid sequences for
COL4A5 exons 9 and 10 as determined in normal and affected male Navasota
dogs with X-linked Alport syndrome. A 10bp deletion in exon 9 causes
X-linked AS in NAV dogs.
Although diagnosis by skin
immunohistochemistry is effective, it requires more time and is more
invasive for the dogs than is a genetic test. Therefore, a
mutation-based test was developed to detect the 10bp deletion specific
to the NAV dogs. The genetic test requires genomic DNA, which can be
isolated from buccal swabs collected when the puppies are a few days
old. The genotyping of the dogs is fast and their status can be
determined within 10-12 days of the litter being born. It is for these
reasons that this test is now used as the primary diagnostic tool for
the Nav dogs. (Fig. 2)
Another form of hereditary
nephropathy is currently being studied in the ECS, which present with
Autosomal Recessive Alport Syndrome (ARAS).
Figure 2. Example of a mutation based
test for X-linked Alport Syndrome in the Navasota Dog. Shown are Ajay
(affected male), Alan (normal male) and Bea (carrier female).
Immunohistochemistry is also performed on the ECS to determine their
status. When performed, the affected dogs show no COL4A3 or COL4A4
protein expression. Currently, it is unknown which of the two genes
harbors the mutation that leads to ARAS. Sequencing must be done for
this to be determined and for a genetic test to be developed.
Transcriptional profiling of renal cortex from NAV dogs exhibiting
advanced renal dysfunction resulting from XLAS and related, normal dogs
of similar age was performed using a canine oligonucleotide array in
collaboration with Eli Lilly and Company. The transcriptional profiling
data show marked differences in gene expression that are correlated with
morphologic changes present in kidneys from XLAS-affected dogs. (Fig.
3)
At
the transcriptional level, approximately 1200 genes were differentially
expressed (i.e., differences greater than 2-fold) in kidneys of affected
dogs compared to controls. Quantitative RT-PCR confirmed the microarray
expression profiles of 14 clinically interesting genes. Differences
in levels of expression were consistent with observed histological
findings of chronic inflammation and fibrosis, as evidenced by the
marked up-regulation of inflammatory mediators (e.g., gp80,
MCP1), interstitial collagens (COL1A1 and COL1A2) and
matrix remodeling proteins (e.g., TIMP1). This microarray,
however, is not state of the art, therefore, utilizing the chip provided
by Viagen, Inc. will provide us with more accurate data.
Recently, two graduate students, Rebecca Campbell and Ashley Davidson,
utilized the Leica AS LMB Laser Microdissection System at the University
of Minnesota Medical School to isolate glomeruli from renal cortex of
NAV and ECS kidney. The isolated glomeruli are stored in RNAlater until
they are ready to be run on the oligonucleotide array.
Figure 3. Microarray image from Eli Lilly
and Company. The four lanes on the left are four normal Nav dogs, while
the four lanes on the right are four affected Nav dogs. The red color
indicates an upregulation of gene expression.
PART 1.
Background, preliminary data and objective for
study of FN in the ECS
Familial nephropathy is a hereditary disease of the glomerulus that leads
to progressive renal failure. As mentioned, FN presents similarly to
Alport syndrome, a disease of the human. An assortment of clinical
phenotypes has been included under the category of AS, and different forms
of AS are transmitted in X-linked (XLAS), autosomal recessive (ARAS), and
autosomal dominant (ADAS) fashions. Although the phenotypic spectrum of AS
is diverse, the underlying structural abnormalities that are common to all
forms of the disease are defective basement membranes in various organs.
The findings common to all forms of AS include multilaminar splitting of
GBM ultrastructure, hematuria, and proteinuria. The reasons for these GBM
abnormalities are known for XLAS and ARAS. That is, mutations in one of
three genes (COL4A3, COL4A4, COL4A5) encoding α-chains of type IV
collagen are responsible for collagen-related AS. XLAS and ARAS have
identical clinical manifestations, and are characterized by the absence of
COL4A3, COL4A4, or COL4A5 in the GBM of affected individuals. Genetic
causes of the rare autosomal dominant forms of AS are obscure.
While
it is true that diverse clinical phenotypes and modes of genetic
transmission exist under the designation of AS, the great majority (more
than 95%) of all human cases are either XLAS or ARAS. The human COL4A5
gene is located on the X chromosome at Xq22.3, and this is also true of
the canine COL4A5 gene. ARAS, which accounts for a much smaller
percentage of human cases, results from mutations in the COL4A3 and
COL4A4 genes, which are found on chromosome 2 in humans and chromosome
25 in the dog.
Renal
function becomes impaired in X-linked and autosomal recessive forms of AS
because the GBM lacks a crucial type IV collagen network containing
COL4A3, COL4A4, and COL4A5 that is required for long-term stability of the
GBM. This network is an assembly of heterotrimeric proteins containing
each of these three peptides, and absence of one any of the three chains
precludes formation of the network. Thus, a mutation in any of the genes
encoding COL4A3, COL4A4, and COL4A5 results in a
dominant negative effect. The consequence of such mutations is that
integrity of the GBM becomes compromised and chronic progressive renal
disease inevitably ensues.
The
progressive alterations in GBM ultrastructure are associated with
progressive changes in glomerular function. Permselectivity of the
glomerular filtration barrier becomes altered and proteinuria develops.
Glomerulosclerosis (progressive glomerular injury and scarring) occurs
such that over time individual glomeruli cease filtration entirely.
Progressive loss of glomerular filtration rate (GFR) eventually leads to
renal failure. These advancing glomerular changes are accompanied by
progressive injury, inflammation and scarring affecting the tubules and
interstitium of the renal cortex. Thus, although the nephropathy
associated with AS is initiated by molecular defects in the GBM, the
entire kidney eventually becomes involved in the progressive structural
damage and functional deterioration that culminate with end stage renal
disease (ESRD).
A form
of ARAS has been described in the English Cocker Spaniel. These dogs
exhibit classic Alport syndrome symptoms such as proteinuria at five to
six months of age, azotemia at two to nine months of age, juvenile-onset
renal failure, and GBM thickening and splitting seen with transmission
electron microscopy. Similar to XLAS in other breeds this disease is
diagnosed by immunofluorescence (IF). In dogs affected with ARAS staining
for COL4A3 and COL4A4 is not present, while staining for COL4A5 is greatly
decreased and COL4A1 and COL4A2 staining is increased. This is contrary to
staining seen in dogs affected with XLAS in which staining for COL4A3,
COL4A4 and COL4A5 is absent. It has also been noted that immunolabeling
for COL4A6 is age dependent, present in affected ECS dogs over 45 months
of age, but not in dogs under 30 months of age.
The
absence of COL4A3 and COL4A4 staining in affected dogs points to the two
genes which code for these collagens as candidate genes for the mutation
causative for ARAS. In December of 2003 the graduate student, Dr Zanaido
Tres Camacho, previously working on ARAS in the ECS, reported his
characterization of COL4A3 and COL4A4. He sequenced the two
genes from affected ECS and three normal dogs (non-ECS breeds). For the
COL4A33 gene, 4,643 bases were characterized leaving ~275 bases at the
5' end of the coding region uncharacterized. From the COL4A4 gene,
5,163 bases were characterized leaving ~50 bases at the 3' end of the
coding region uncharacterized. Dr. Camacho identified three polymorphisms
within his sequenced regions of the two genes that could play a role as
causative mutations for FN in the ECS (two in COL4A3 and one in
COL4A4).
Since
Dr. Camacho reported his characterization we have collected samples and
pedigree information for 69 ECS dogs, three of which have been diagnosed
with AS. These samples include DNA from blood, RNA from blood, and for the
three affected dogs RNA from renal tissue. Using these samples we have
been further investigating the polymorphisms Dr. Camacho identified as
possible causative mutations. To date, we have been able to rule out one
polymorphism and work continues to confirm or exclude the remaining two.
We
have also analyzed dogs for linkage disequilibrium using ten total
microsatellite markers found on chromosome 25 (Table 1), the chromosome on
which COL4A3 and COL4A4 reside (note: the PI’s laboratory
mapped the type IV collagens and this work was published in 2003). These
markers include the two which, on the current canine RH map, mapped the
closest to the two genes of interest, flanking their head to head
orientation. Markers thought most likely to show linkage were tested on
more dogs than those which were less likely to show linkage. No difference
between affected and unaffected dogs was found and thus no further
analysis was performed.
|
Name of Microsatellite Marker |
Number of Dogs Analyzed |
Number of Alleles Observed |
|
C25.213 |
11 |
3 |
|
FH2526 |
12 |
6 |
|
FH2141 |
12 |
8 |
|
FH3627 |
60 |
9 |
|
REN54E19 |
10 |
2 |
|
FH3245 |
9 |
6 |
|
FH2324 |
10 |
4 |
|
FH4027 |
7 |
10 |
|
FH3327 |
9 |
5 |
|
FH3101 |
24 |
2 |
Table 1. List of microsatellite markers
tested for linkage disequilibrium analysis along with the number of dogs
tested and the number of alleles observed for each marker.
Work continues to
identify the causative mutation for ARAS in the ECS. We will carry on with
investigation of the polymorphisms in COL4A3 and COL4A4. If
this proves unsuccessful we will look for the causative mutation elsewhere
in the two candidate genes, comparing affected ECS sequence to unaffected
ECS. Once a causative mutation is characterized a genetic based test can
be developed which will allow elucidation of carrier dogs in order for
breeders to make educated decisions about matings in order to help
eliminate AS from the breed. That is, we will do for the ECS exactly
what we have done for the NAV dogs.
PART II.
Background, preliminary data and objective for
comparative study of FN in the ECS and NAV dog
NOTE: This section is more detailed
because the owners, breeders, veterinarians, etc. may not be familiar with
this approach to understanding the genetic changes that accompany FN.
By
utilizing the canine specific oligonucleotide array, it will be possible
to analyze gene expression solely in the glomerulus. After trends have
been established, they will be verified by quantitative real time PCR (Q-RT-PCR).
This information can be compared to the data obtained from the previous
experiments using whole renal cortex, thus establishing activity in both
the glomerulus and tubulointerstitium. In addition to studying the
diseases individually, comparisons can be made between two forms of Alport
Syndrome (AS): XLAS and ARAS. In addition, the data may provide more
insight as to the gene harboring the causative mutation for ARAS in the
ECS.
Expected outcome, significance and application of findings.
Funds are requested to (1) identify the causative mutation for FN in the
ECS and (2) use state of the art technology to further dissect the
genetics of FN. Execution of (1) will be followed by development of a
genetic test so that carriers may be identified and this information can
be considered when planning breedings. The purpose of (2) is to study the
differences in gene expression in the glomeruli between normal and
affected dogs with XLAS and ARAS. Not only will the affected ECS and NAV
dogs be compared to their normal counterparts, but also to each other. In
addition, by incorporating previous data, the differences between gene
expression in the glomeruli can be compared to the renal cortex as a
whole.
Many
techniques have been developed to examine gene expression levels, and DNA
microarrays now allow a comprehensive study of global gene expression of
many disease models. Microarrays have myriad applications to the study of
nephrology (Hsiao et al. 2000, Hayden et al.2003), including the
opportunity to clarify molecular mechanisms of normal or disturbed organ
or cellular function, and studies of these kinds have been carried out in
the human and the mouse (Sarwal et al. 2003; Yuan et al 2003).
Although type IV collagen
abnormalities have been identified as the inciting cause of AS, important
aspects of AS remain ill defined (Kashtan 2002). For example, the complete
absence of the GBM COL4A3/COL4A4/COL4A5 network
does not impair glomerular development nor does it cause glomerular
function to be abnormal early in life (Harvey et al. 1998). Also,
mechanisms linking the type IV collagen defects to subsequent events,
beginning with GBM changes and culminating with ESRD, are incompletely
understood (Kashtan, 2002). Moreover, treatments of proven efficacy to
retard or halt progression of renal failure in AS patients have not been
developed (Cosgrove et al. 1996, Lu, 1999; Miner and Sanes 1996). Analysis
of ESRD in end-stage kidneys by microarray will allow the elucidation of
disease processes at the molecular level, leading to the development of
possible biomarkers for chronic renal failure, and potential treatments
via molecular targets.
Research design and methods. This portion of
the proposal is straightforward. The laboratory has extensive expertise in
using microarrays (please see CV) and has worked with Viagen, Inc. on
other projects as well (i.e., pancreatic acinar atrophy in the German
Shepherd Dog, and encephalitis in the Pug). The glomeruli previously
isolated and stored in RNAlater will be sent to Viagen, Inc. for use on
their canine specific oligonucleotide array; renal cortex from dogs will
also be sent. The renal cortex is composed of tubulointerstitium and
glomeruli. By using both isolated glomeruli and renal cortex, we will be
able to further elucidate the genetic changes occurring in the glomeruli,
which is where the disease originates. Isolated glomeruli from two normal
and two affected NAV and ECS dogs will be sent along with renal cortex
from the same dogs. (Table 1) Once general trends have been determined
from the microarray data, clinically interesting genes will be selected
for further analysis using quantitative real time PCR.
|
Tissue
|
Navasota Dogs
|
English Cocker Spaniel
|
|
Glomeruli
|
2- affected
Nate and Norm
2-normal
Oscar and Vaughn |
2-affected
Melissa and Mayer
2-normal
Daphne and Frasier
|
|
Renal Cortex
|
2-affected
Nate and Norm
2-normal
Oscar and Vaughn
|
2-affected
Melissa and Mayer
2-normal
Daphne and Frasier
|
Table
1. List of dogs and tissue to be used for the study.
The
chip to be used is owned by Viagen, Inc. This chip, ViaGen01a520025, was
customarily designed and manufactured by Affymetrix. The canine sequences
were obtained from publicly accessible GenBank, dbEST, or from the
proprietary canine genomic database of Celera Genomics. Probes were
designed with standard Affymetrix algorithms. The chip features 15,615
sets of canine-specific probes.
Total
RNAs will be isolated by the method of Gauthier et al. and purified.
Synthesis of first strand cDNA, second strand cDNA, and
biotin-labeled cRNA will be carried out with a linear RNA amplification
kit. Two μg of total RNA will be used to start the single round of
amplification. Duplicate experiments will also be performed for all
samples.
Labeled cRNA will be fragmented at 95oC
for 35 min in a solution containing 40 mM Tris-acetate (pH 8.1), 100 mM
KOAc, and 30 mM MgOAc. Forty μg of fragmented cRNA will be
hybridized to each array. The chips will then be washed, stained and
scanned.
GeneChip® images will be collected on the high resolution GeneChip Scanner
3000. Image data will be quantified and gene expression values calculated
using Affymetrix GeneChip Operating Software. Computer software will be
used to perform gene clustering, fold change, Students’ t-test, and
Bonferroni multiple testing corrections. To identify differentially
expressed genes between normal and diseased tissues, affected samples and
normal samples will be grouped separately, and gene expression ratios
between the two will be calculated. The GeneCards database (http://bioinfo.weizmann.ac.il/cards/)
will be used to classify genes into groups based on molecular function.
First
strand cDNA will be synthesized using 2 μg of total RNA. TaqMan probes and
forward and reverse PCR primers will be designed using a software program.
Primers as well as FAM and TAMRA-labeled TaqMan probes will be
synthesized. TaqMan reactions will be performed in triplicate for each
gene in a mixture containing 1 μl of the first-strand cDNA, 2.5 μl of 10 x
PCR buffer (Sigma, St. Louise, MO), 5 mM MgCl2, 300 μM dNTPs,
300 nM each of forward and reverse primers, 150 nM TaqMan probe, 1.25
units of Taq DNA polymerase and ddH2O in a volume of 25 μl on a
fluorescence detection thermal-cycler. Average Threshold Cycle (Ct) will
be calculated from triplicates for each gene and used for subsequent
analysis.
These
data will provide insight into (1) gene expression in canine AS, (2)
possibly provide insight into which gene is causative for ARAS in the ECS
and (3) provide genetic markers for clinical use in diagnosis of ESRD in
the dog.
Literature cited
Brown SA, Finco DR, Brown CA,
Crowell WA, Alva R, Ericsson GE, Cooper T. (2003). Evaluation of the
effects of inhibition of angiotensin converting enzyme with enalapril in
dogs with induced chronic renal insufficiency. Am J Vet Res.64:
321-7.
Cosgrove D, Meehan DT, Grunkemeyer
JA, Kornak JM, Sayers R, Hunter WJ, Samuelson GC. (1996) Collagen
COL4A3 knockout: a mouse model for autosomal Alport syndrome. Genes
Dev 10: 2981-2992.
Cox ML, Lees GE, Kashtan CE,
Murphy KE. (2003). Genetic cause of X-linked Alport syndrome in a family
of domestic dogs. Mamm Genome. 14: 396-403.
Hayden PS, El-Meanawy A, Schelling
JR, Sedor JR. (2003). DNA expression analysis: serial analysis of gene
expression, microarrays and kidney disease. Curr Opin Nephrol Hypertens.
12: 407-14.
Harvey SJ, Zheng K, Sado Y, Naito
I, Ninomiya Y, Jacobs RM, Hudson BG, Thorner PS. (1998). Role of distinct
type IV collagen networks in glomerular development and function.
Kidney Int.54: 1857-66.
Hostikka SL, Eddy RL, Byers MG,
Hoyhtya M, Shows TB, Tryggvason K. (1990) Identification of a distinct
type IV collagen alpha chain with restricted kidney distribution and
assignment of its gene to the locus of X chromosome-linked Alport
syndrome. Proc Natl Acad Sci U S A. 87: 1606-10.
Hsiao LL, Stears RL, Hong RL,
Gullans SR. (2000). Prospective use of DNA microarrays for evaluating
renal function and disease. Curr Opin Nephrol Hypertens .9:
253-8.
Kashtan CE. (2002). Animal models
of Alport syndrome. Nephrol Dial Transplant. 17: 1359-62.
Lees GE, Helman RG, Kashtan CE,
Michael AF, Homco LD, Millichamp NJ, Camacho ZT, Templeton JW, Ninomiya Y,
Sado Y, Naito I, Kim Y. (1999). New form of X-linked dominant hereditary
nephritis in dogs. Am J Vet Res. 60: 373-83.
Lowe JK, Guyon R, Cox ML, Mitchell
DC, Lonkar AL, Lingaas F, Andre C, Galibert F, Ostrander EA, Murphy KE.
(2003). Radiation hybrid mapping of the canine type I and type IV collagen
gene subfamilies. Funct Integr Genomics. 3: 112-6.
Lu W, Phillips CL, Killen PD,
Hlaing T, Harrison WR, Elder FFB, Miner JH, Overbeek PA, Meisler MH.
(1999). Insertional mutation of the collagen genes COL4A3 and
COL4A4 and in a mouse model of Alport syndrome. Genomics 61:
113-124
Miner JH, Sanes, JR. (1996)
Molecular and functional defects in kidneys of mice lacking collagen
α3(IV): Implications for Alport syndrome. J Cell Biol 135:
1403-1413.
Sarwal M, Chua MS, Kambham N,
Hsieh SC, Satterwhite T, Masek M, Salvatierra O Jr. (2003). Molecular
heterogeneity in acute renal allograft rejection identified by DNA
microarray profiling. N Engl J Med. 349: 125-38.
Zhou C, Yu Z, Li R, Tian Z. (2001)
The principle and technique of using Chinese drugs in the treatment of
hypertension. J Tradit Chin Med. 21: 7-11.
 |